From Dates in the Month of May that Are of Interest to Linguists by the late James D. McCawley:

May 6, 1939. The University of Chicago trades Leonard Bloomfield to Yale University for two janitors and an undisclosed number of concrete gargoyles.

May 23, 38,471 B.C. God creates language.

May 29, 1962. Angular brackets are discovered. Classes at M.I.T. are dismissed and much Latvian plum brandy is consumed.

May 31, 1951. Chomsky discovers Affix-hopping and is reprimanded by his father for discovering rules on shabas.

Unfortunately May 31, 1951 was a Thursday…

Related posts:

1. Localizing Ubiquity: an open letter to linguists
2. Jerry Sadock’s Automodular Grammar on iTunes
3. Bathroom Graffiti

Related posts brought to you by Yet Another Related Posts Plugin.

From the 2004 Scav Hunt list:

Item 80. Brain Farts: The Collected Works of The University of Chicago Bathroom Graffiti (organized by theme, but attributed to location). [102 points. 15 bonus points for an inset detailing the entirety of the “Grout Work.”]

I spent a day or so going around campus with a friend (so I didn’t have to be snooping around in ladies’ rooms) taking pictures and compiled the booklet. In good Scav Hunt spirit, I opened the booklet with this tongue in cheek forward:

The anonymity and collaborative nature of bathroom graffiti makes it an amazing reflection of the world we live in. People can write what they want to in their own honest words—it is a clear window into the modern human psyche.

Oddly enough, the latter part of this passage on anonymity jives with Dean Levmore’s talk. For posterity’s sake, I’ve made a compressed—but still pretty big—PDF version available here:

Make sure not to miss the highlight: the three pages of grout-fiti, collected from three different buildings. I might even venture to say it’s the groutest collection of egroutica ever compiled.

Related posts:

1. Scav Hunt!
2. Krashen The Party
3. Jerry Sadock’s Automodular Grammar on iTunes

Related posts brought to you by Yet Another Related Posts Plugin.

It’s that time of the year again—Mother’s Day weekend—and that means Scav Hunt! Every year at the University of Chicago we have a huge Scavenger Hunt (a.k.a. “Scav,” or “The Hunt”). On Wednesday night at midnight, a list of roughly 300 items is released in some obfuscated fashion. The items are to be presented three days later, on Judgement Day (Sunday). While some items are simply rare and must be found, most are some sort of construction, production, or art project. There are also some other scav staples: some of the items make up the Scav Olympics, the Party on the Quads, Scav All Stars, and the Road Trip.

The Road Trips

As an undergrad I drove my trusty Toyota Camry (“Erlewine Carpool of Love”) and participated in the Scav Road Trip twice, my second year for Pierce and my fourth year for the Shoreland. Some people are in charge of research overnight and you’re woken up Thursday morning with a map in hand, some costume you’re supposed to put on, and your car decorated in some fashion. They give you a route and tell you to be back in time for judgment. My second year, fellow linguist and brother Bob Peachey, Liz, and Tiffany (with whom I oddly enough had worked together at 森林湖 a year or so before then) went up Wisconsin, across the Upper Peninsula of Michigan, dipped into Canada, and drove back down to Chicago in three days. Feel free to check out the full gallery of photos.

My fourth year of college, Bailey, my life partner Evan Jenkins, our friend Jane, and I went on a long-distance adventure, across Wisconsin, southern Minnesota, South Dakota, to the Black Hills and Mt. Rushmore, down through Nebraska and Iowa, in three days. It was a marathon Road Trip route, but we still had a great deal of fun. Again, check out the full gallery.

Also check out the Badlands video we made, which was one of our items.

Scav Hunt 2008

This year’s list was just released and it continues the Chicago tradition of wit, humor, intellect, and crazy crazy fun. While no longer in Chicago, I’m still helping the Shoreland team this year, running a bbpress bulletin board system on my server to manage the progress of all our Items. I also did some road trip research… oddly enough, this is the first time that being thirteen hours ahead has been a good thing.

My fantasy Scav items

I myself actually applied to be a judge for my fourth year… unfortunately I had a scheduling mixup and couldn’t make the interview. Here, for the first time in history, however, I will make public the items I submitted as part of my application. If any of these show up on future lists, the world will know where credit is due:

1. …GACCTGGACGCCACACACTGTACCTGTTGCGATAGTGGAGTACCGTCGCTGGAGA
   AAGGCACTGTAGTTATTACTCGCTACTCCCGCACCCTTT… [20 edible points]
2. A flight data recorder. [30 points]
3. ∃x(CAPTAIN(x) ∧ ∀y(SPEAK(x, y) → LOGLAN(y))). [⋆ points]
4. Zipper prom is the new duct tape prom. [50 points per couple]
5. A ramen vending machine. No people dressed up in boxes, thank you—we want the real deal. Must be free for judges. [50 points]
6. A letter from your congressperson, agreeing to support legislation for a Chomskian Sin Tax, if brought to the floor. [15 points]
7. “Zimmer: The Musical.” Send three team members to (place) at (time): a singer, a writer, and an instrumenter. The show goes up at (a later time) at (another place). [30 points per participating team member]
8. Show the world that our faculty be pimpin’. Install spinning rims on your favorite professor’s car. The professor themself must drive the car to Judgement Day. [40 points; 80 points for the Zimmster]
9. Feces perfume. [23 points]
10. Is the water from Botany Pond safe to drink? Check against the EPA NPDWR MCL’s. [up to 60 points]
11. Procure the following:
    • 赤巻紙青巻紙黄巻紙 [3点]
    • 生麦生米生卵 [3点]
    • 引き抜きにくい挽き肉は引き抜きにくい温い肉 [10点]
    • 骨粗鬆症訴訟勝訴 [40点;英語でもよし]
    • 東京都特許許可局 [※点]
12. Get married. Sign your papers at judgment. [50 points]
13. Ever played Lemonade Stand on the Apple //e? Yeah, so did we. Bring us a copy and a //e so we can play. [30 points, 5 points bonus if you beat us]
14. Musical Department Chairs. You bring your best Chair to (place) at (time) . [15 points for participation, 50 points if your Chair wins]
15. The Trabb Pardo-Knuth algorithm? brainfuck it! [10 points]
16. A Proof movie poster, signed by five people in the film, with vidcap proof. [50 points]
17. UChicago Answers. Refer practical questions to Google Answers. [75 points]
18. Straight A’s won’t help you now. Bring us one (1) official U of C transcript. [3 points per distinct grade code]
19. It’s Stroganoff Fest 2007!
    • beef stroganoff [2 points]
    • frog stroganoff [7 points]
    • rabbit stroganoff [7 points]
    • Michael Strogoff stroganoff [7 points]
    • tofu stroganoff [8 points]
    • Kung Fu stroganoff [10]
    • Shaq Fu stroganoff [12 points]
    • Hufu stroganoff [25 points]
20. TOYNBEE IDEA
    IN MOVIE 2001 
    RESURRECT DEAD
    ON THE QUADS [100 points]
21. Only one Cucumber can survive! It’s Larry vs. Bob, à la Extreme Championship Wrestling. Now on DVD.
22. Domesticate a Hyde Park parakeet. [20 points]
23. Distribute the pamphlet “Putting the ‘Sensual’ Back in ‘Non-Consensual”’ on the Quads. [? points]
24. Affect the Rapture Index. [20/3 points]
25. Regenstein Puzz-3D. [13 points]
26. Schönfinkelised chicken. [3 points]
27. The Blagoynich manuscript. [12 points]
28. Hello Kitty® Litter. [5 points]
29. Pyjamas in bananas [2 points]
30. Do any of the above, on a numbers station. [10 bonus points]

Related posts:

1. Bailey won the Japanese Language Speech Contest
2. Lantern Festival

Related posts brought to you by Yet Another Related Posts Plugin.

The Shoreland’s 13 floors, hundreds of rooms, will be a dorm for another year or so before it’s transformed into high-end condominiums. Meanwhile, plaster sifts from the ceilings, and the lobby is a mishmash of couches, stacks of student publications, a big-screen TV and handbills covering the walls. A friendly, bored staff of desk attendants watches as students — listless, sleepy, harried, running late, dressed to the nines, falling down drunk, depending on the day and hour — file past.

Accurate. I can vividly visualize the scenes he describes. Funny, I miss the Shoreland.

(via Bailey)

Related posts:

1. Bailey’s in the Tribune!
2. The Nerd Handbook

Related posts brought to you by Yet Another Related Posts Plugin.

I recently got Daring Fireball‘ed too,² so that almost makes us a celebrity couple.

I personally like the caption right above. That’s the same story, right?

Related posts:

1. Great news! You can opt-out from Omniture’s 192.168.112.2o7.net

Related posts brought to you by Yet Another Related Posts Plugin.

‘Setting Language Research to Music’ is a Newcastle University project whose aim is to compose orchestra and choral music to demonstrate infant perception and production. The first piece of music to emerge from the project, ‘Swing Cycle’, mimics babies’ experience of discovering word boundaries, taking work by Peter Jusczyk and colleagues as a starting point.

It’s the craziest thing I’ve seen in a long while… it reminds me of the Music: Materials and Design course I took a couple years ago. My final project was an electronic composition building a rhythm with political speech samples and echos and cracking noises, representing the hollowness of political rhetoric. It was one of my academic low points at Chicago, for sure.

Maybe it’s because I’m an artist, but I’ve never understood the drive for modern art, including compositions like these. I would much rather listen to some music and read about language acquisition separately… the motivation to combine the two eludes me.

You can listen to The Swing Cycle and read the lyrics (or their approximation) on the Setting Language Research to Music website.

Related posts:

1. Concordia Language Villages’ Twin Cities expansion
2. Krashen The Party

Related posts brought to you by Yet Another Related Posts Plugin.

Krashen is kind of like the Chomsky of language acquisition and teaching—a huge and controversial (some may say incendiary) figure who you can love or hate, but can’t ignore. Last Wednesday in our weekly workshop, Dr. Collins delivered a chronological run down of Krashen’s theories.¹ As an entertaining aside, one task given to us was to draw a schematic diagram of Krashen’s view of language acquisition and production. Below is Dale’s drawing, which eerily reflects the geography of the brain… the input comes in through the ears (or eyes, at the back of the brain), then hits the Affective Filter (the amygdala), goes to the Language Acquisition Device (the Broca’s and Wernicke’s areas), then the output is filtered by the Monitor—a product of conscious learning—(the frontal lobe). Pretty creepy.

Krashen’s talk² was fascinating, albeit not what I expected: given that the workshop’s focus was on the teaching of reading and that he himself has been a big advocate of recreational reading for language learners, I expected more on teaching English reading as to non-native speakers. The majority of the talk, though, was on writing and the composing process: “reading more makes you a better writer, but writing more makes you smart.” He talked about how the act of (regular) writing clarifies and organizes our thoughts, and advocated for a writing process which involved much revision as, “every time you have to revise, it means you’ve become smarter,” and building relaxation (to allow for eureka moments) into the process. His conclusion and analysis are important for first-language speakers just as much as the second-language learner, and the talk did feel more like a writing seminar than a pedagogical one. Krashen is an engaging and entertaining speaker, using many examples from famous writers and common experience to draw his conclusion.

The intensity with which he spoke and the passion for thinking about thinking reminded me of Sally’s Honors Analysis class, which was as much about thinking as it was about mathematics. Sally once told us that, when we’re stuck on a problem, we should find someone just about as smart as us and just explain the problem to them. He claimed that the majority of the time, the simple process of explaining the problem outloud and answering clarifying questions would make the solution come to us. It’s a powerful technique that I’ve used many times at Chicago and elsewhere, and Krashen’s analysis of what happens when we write thus struck a chord with me.

Afterwards I was fortunate enough to go out to dinner with the speakers, some of our advisors, and some faculty from the Institute that hosted the workshop. I had some great conversations about my background, where my future directions may lie academically, and of course the ideas. ^^ It reminded me of dinners with linguists back at home, after a workshop or CLS. I realized I miss the fraternity of academia—the sense of mutual respect and interest academics have for each other’s work and ideas, even if the “other” is only 22 years old.

Related posts:

1. Affirmative action, Taiwan style
2. Oh Evan
3. English Easy Go!

Related posts brought to you by Yet Another Related Posts Plugin.

Together, at last. I feel so honored.

No related posts.

Related posts brought to you by Yet Another Related Posts Plugin.